DEVELOPMENT OF SPECIES-SPECIFIC PRIMERS  FOR THE IDENTIFICATION OF Colletotrichum musae IN BANANAS

Phan Vương Ái Vy; Nguyễn Lam Minh; Nguyễn Thị Liên

doi:10.34238/tnu-jst.9088

DEVELOPMENT OF SPECIES-SPECIFIC PRIMERS FOR THE IDENTIFICATION OF Colletotrichum musae IN BANANAS

About this article

Received: 28/10/23 Revised: 05/03/24 Published: 11/03/24

Authors

1. Phan Vuong ai Vy, Institute of Food and Biotechnology - Can Tho University
2. Nguyen Lam Minh, Institute of Food and Biotechnology - Can Tho University
3. Nguyen Thi Lien , Institute of Food and Biotechnology - Can Tho University

Abstract

Bananas (Musa spp.) is an important crop which has high economic and nutritional values, but it is also very susceptible to diseases, especially anthracnose caused by Colletotrichum spp. In particular, Colletotrichum musae is the most common pathogen causing banana anthracnose and leading to yield loss. Therefore, developing a method for identification of C. musae has received a lot of attention from scientists, recently. In this study, Colletotrichum spp. were isolated from anthracnose lesions of different banana cultivars collected in Viet Nam including Can Tho, Da Lat, Hau Giang, Soc Trang and Vinh Long. Pathogenicity of fungal strains was tested using 3 common banana cultivars in Vietnam (Gia, Xiem and Cau). Specific primers for C. musae were designed on the glyceraldehyde-3-phosphate dehydrogenase (GADPH) gene sequence to accurately identify C. musae causing anthracnose on bananas. In this study, 11 strains of Colletotrichum spp. were isolated from anthracnose lesions. Of which, the G2 strain showed the highest pathogenicity (lesion diameter: 19.33 mm) while the CA strain had the lowest pathogenicity (lesion diameter: 7.44 mm). The two primers CM1 (5' CCGCTGTAATCTACATCTC 3') and CM2 (5' CTGATATGAGTGATAGCATGTA 3') were designed to generate the 115-bp DNA amplicon, a specific product for Colletotrichum musae. PCR results showed that 6/11 isolated fungal strains were identified as C. musae. These strains have the highest pathogenicity in the pathogenicity test, especially the G2 strain.

Keywords

Anthracnose; Colletotrichum musae; Colletotrichum spp.; GADPH; Specific primer

Full Text:

PDF

References

[1] N. Roux, J. Doležel, R. Swennen, and F. J. Zapata-Arias, “Effectiveness of three micropropagation techniques to dissociate cytochimeras in Musa spp.,” Plant Cell, Tissue and Organ Culture, vol. 66, no. 3, pp. 189-197, 2001.

[2] R. Vilaplana, L. Pazmiño, and S. Valencia-Chamorro, “Control of anthracnose, caused by Colletotrichum musae, on postharvest organic banana by thyme oil,” Postharvest Biology and Technology, vol. 138, pp. 56-63, 2018.

[3] G. Sangeetha, A. Anandan, and R. Viswanathan, “Morphological and molecular characterization of Colletotrichum musae isolates from various banana (Musa spp.) cultivars,” Acta Phytopathologica et Entomologica Hungarica, vol. 46, no. 2, 191-202, 2010.

[4] M. Du, C. L. Schardl, E. M. Nuckles, and L. J. Vaillancourt, “Using mating-type gene sequences for improved phylogenetic resolution of Colletotrichum species complexes,” Mycologia, vol. 97, no. 3, pp. 641-658, 2005.

[5] U. Damm, R. Baroncelli, L. Cai, Y. Kubo, R. O’Connell, B. Weir, K. Yoshino, and P. F. Cannon, “Colletotrichum: species, ecology and interactions,” IMA Fungus, vol. 1, no. 2, pp. 161-165, 2010.

[6] R. Huang, W. Sun, L. Wang, Q. Li, S. Huang, L. Tang, T. Guo, J. Mo, and T. Hsiang, “Identification and characterization of Colletotrichum species associated with anthracnose disease of banana,” Plant Pathology, vol. 70, no. 8, pp. 1-11, 2021.

[7] U. Krauss, R. Bidwell, and J. Ince, “Isolation and preliminary evaluation of mycoparasites as biocontrol agents of crown rot of banana,” Biological Control, vol. 13, no. 2, pp. 111-119, 1998.

[8] R. H. Stover and N. W. Simmonds, “Disease and disorders,” in Bananas, R. H. Stover and N. W. Simmonds, Eds. New York: Wiley, 1987, pp. 281-323.

[9] D. S. Meredith, “Studies on Gloeosporium musarum Cke. & Mass. causing storage rots of Jamaican Banana,” Anthracnose and its chemical control, vol. 48, no. 2, pp. 279-290, 1960.

[10] J. Cano, J. Guarro, and J. Gené, “Molecular and morphological identification of Colletotrichum species of clinical interest,” Journal of Clinical Microbiology, vol. 42, no. 6, pp. 2450-2454, 2004.

[11] P. F. Cannon, P. D. Bridge, and E. Monte, “Linking the past, present and future of Colletotrichum systematics,” In: Colletotrichum: Host specificity, pathology and host-pathogen interaction, D. Prusky, S. Freeman, and M. B. Dickman, Eds. Minnesota: APS PRESS The American Phytopathological Society, 2000, pp. 1-20.

[12] D. S. Hibbett, “Ribosomal RNA and fungal systematics,” Transactions of the Mycological Society of Japan, vol. 33, no. 4, pp. 533-556, 1992.

[13] Y. C. Han, X. G. Zeng, F. Y. Xiang, L. Ren, F. Y. Chen, and Y. C. Gu, “Distribution and characteristics of Colletotrichum spp. associated with anthracnose of strawberry in Hubei, China,” Plant Disease, vol. 100, no. 5, pp. 996–1006, 2015.

[14] B. S. Weir, P. R. Johnston, and U. Damm, “The Colletotrichum gloeosporioides species complex,” Studies in Mycology, vol. 73, no. 1, pp. 115-180, 2012.

[15] W. A. S. Vieira, P. A. Bezerra, A. C. Silva, J. S. Veloso, M. P. S. Câmara, and V. P. Doyle, “Optimal markers for the identification of Colletotrichum species,” Molecular Phylogenetics and Evolution, vol. 143, 2020, Art. no. 106694.

[16] P. R. Johnston and D. Jones, “Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences,” Mycologia, vol. 89, pp. 420-430, 1997.

[17] T. H. Al‐Samarrai and J. Schmid, “A simple method for extraction of fungal genomic DNA,” Letters in Applied Microbiology, vol. 30, no. 1, pp. 53-56, 2000.

[18] B. C. Sutton and J. M. Waterson, “Colletotrichum musae,” in CMI Description of Pathogenic Fungi and Bacteria, no. 222, B. C. Sutton and J. M. Waterson, Eds. London: Eastern Press.

[19] J. Lim, T. H. Lim, and B. Cha, “Isolation and identification of Colletotrichum musae from imported bananas,” The Plan Pathology Journal vol. 18, no. 3, pp. 161-164, 2002.

[20] K. A. Abd-Elsalam, S. Roshdy, O. E. Amin, and M. Rabani, “First morphogenetic identification of the fungal pathogen Colletotrichum musae (Phyllachoraceae) from imported bananas in Saudi Arabia,” Genetics and Molecular Research, vol. 9, no. 4, pp. 2335-2342, 2010.

[21] M. A. I. Sakinah, I. V. Suzianti, and Z. Latiffah, “Phenotypic and molecular characterization of Colletotrichum species associated with anthracnose of banana (Musa spp.) in Malaysia,” Genetics and Molecular Research, vol. 13, no. 2, pp. 3627-3637, 2014.

[22] B. C. Sutton, “The Coelomycetes,” Commonwealth Mycological Institute, Kew, 1980.

[23] S. Freeman, T. Katan, and E. Shabi, “Characterization of Colletotrichum species responsible for anthracnose disease of various fruits,” Plant Disease, vol. 82, pp. 596-605, 1998.

[24] Y. Y. Su, P. Noireung, F. Liu, K. D. Hyde, M. A. Moslem, A. H. Bahkali, K. A. Abd-Elsalam, and L. Cai, “Epitypification of Colletotrichum musae, the causative agent of banana anthracnose,” Mycoscience vol. 52, pp. 376-382, 2011.

[25] K. Tomiyama, M. Takakuwa, N. Takase, and R. Sakai, “Alteration of oxidative metabolism in potato tuber cell invaded by Phytophthora infestans and in the neighbouring tissue,” Phytopathologische Zeitschrift, vol. 37, pp. 113-144, 1959.

[26] D. T. Zhang, Y. L. Gao, Y. H. Huang, M. Yang, and E. X. Zhou, “Identification and biological characteristics of the anthracnose pathogen of postharvest banana fruit,” Journal of Huangzhong Agricultural Univeristy, vol. 30, pp. 438-442, 2011.

[27] A. O. Silva, D. C. Savi, F. B. Gomes, F. M. W. R. Gos, Jr G. J. Silva, and C. Glienke, “Identification of Colletotrichum species associated with postbloom fruit drop in Brazil through GAPDH sequencing analysis and multiplex PCR,” European Journal of Plant Pathology, vol. 147, no. 4, pp. 731-748, 2017.

[28] G. Tao, K. D. Hyde, and L. Cai, “Species-specific real-time PCR detection of Colletotrichum kahawae,” Journal of Applied Microbiology, vol. 114, pp. 828-835, 2012.

[29] M. A. Balendres, J. Mendoza, and F. D. Cueva, “Characteristics of Colletotrichum musae PHBN0002 and the susceptibility of popular banana cultivar to postharvest anthracnose,” Indian Phytopathological, vol. 73, pp. 57-64, 2019.

DOI: https://doi.org/10.34238/tnu-jst.9088

Refbacks

There are currently no refbacks.



Remember me