PHÁT TRIỂN MỒI ĐẶC HIỆU MỚI NHẬN DIỆN NẤM Colletotrichum musae TRÊN CHUỐI

Phan Vương Ái Vy; Nguyễn Lam Minh; Nguyễn Thị Liên

doi:10.34238/tnu-jst.9088

PHÁT TRIỂN MỒI ĐẶC HIỆU MỚI NHẬN DIỆN NẤM Colletotrichum musae TRÊN CHUỐI

Thông tin bài báo

Ngày nhận bài: 28/10/23 Ngày hoàn thiện: 05/03/24 Ngày đăng: 11/03/24

Các tác giả

1. Phan Vương Ái Vy, Viện Công nghệ sinh học và Thực phẩm - Trường Đại học Cần Thơ
2. Nguyễn Lam Minh, Viện Công nghệ sinh học và Thực phẩm - Trường Đại học Cần Thơ
3. Nguyễn Thị Liên , Viện Công nghệ sinh học và Thực phẩm - Trường Đại học Cần Thơ

Tóm tắt

Chuối (Musa spp.) là cây trồng quan trọng, có giá trị kinh tế, dinh dưỡng cao và rất dễ mắc bệnh, đặc biệt là bệnh thán thư gây ra bởinấm Colletotrichum spp. Trong đó, nấm Colletotrichum musae là tác nhân gây bệnh thán thư phổ biến nhất trên cây chuối dẫn đến những thiệt hại nặng nề. Vì vậy, việc nhận diện C. musae hiện nay nhận được rất nhiều sự quan tâm. Trong nghiên cứu này, các chủng Colletotrichum spp. được phân lập từ vết bệnh thán thư trên các giống chuối khác nhau được thu thập ở Việt Nam như thành phố Cần Thơ, thành phố Đà Lạt, tỉnh Hậu Giang, Sóc Trăng và Vĩnh Long. Khả năng gây bệnh của các chủng nấm đã được thử nghiệm trên 3 giống chuối phổ biến ở Việt Nam (chuối Già, chuối Xiêm và chuối Cau). Để xác định chính xác C. musae gây bệnh thán thư trên chuối, cặp mồi đặc hiệu để nhận diện nấm Colletotrichum musae đã được thiết kế dựa trên vùng gen glyceraldehyd-3-phosphate dehydrogenase (GADPH). Trong nghiên cứu này, 11 chủng Colletotrichum spp. đã được phân lập. Chủng G2 có khả năng gây bệnh cao nhất (đường kính vết bệnh: 19,33 mm) trong khi chủng CA có khả năng gây bệnh thấp nhất (đường kính vết bệnh: 7,44 mm). Cặp mồi được thiết kế CM1 (5' CCGCTGTAATCTACATCTC 3') và CM2 (5' CTGATATGAGTGATAGCATGTA 3') khuếch đại đoạn DNA có kích thước 115 bp. Dựa trên kết quả PCR khi sử dụng cặp mồi được thiết kế có 6/11 chủng nấm được xác định là C. musae, các chủng này có khả năng gây bệnh cao nhất trong thử nghiệm lây bệnh nhân tạo, đặc biệt là chủng G2.

Từ khóa

Bệnh thán thư; Colletotrichum musae; Colletotrichum spp.; GADPH; Mồi đặc hiệu

Toàn văn:

PDF (English)

Tài liệu tham khảo

[1] N. Roux, J. Doležel, R. Swennen, and F. J. Zapata-Arias, “Effectiveness of three micropropagation techniques to dissociate cytochimeras in Musa spp.,” Plant Cell, Tissue and Organ Culture, vol. 66, no. 3, pp. 189-197, 2001.

[2] R. Vilaplana, L. Pazmiño, and S. Valencia-Chamorro, “Control of anthracnose, caused by Colletotrichum musae, on postharvest organic banana by thyme oil,” Postharvest Biology and Technology, vol. 138, pp. 56-63, 2018.

[3] G. Sangeetha, A. Anandan, and R. Viswanathan, “Morphological and molecular characterization of Colletotrichum musae isolates from various banana (Musa spp.) cultivars,” Acta Phytopathologica et Entomologica Hungarica, vol. 46, no. 2, 191-202, 2010.

[4] M. Du, C. L. Schardl, E. M. Nuckles, and L. J. Vaillancourt, “Using mating-type gene sequences for improved phylogenetic resolution of Colletotrichum species complexes,” Mycologia, vol. 97, no. 3, pp. 641-658, 2005.

[5] U. Damm, R. Baroncelli, L. Cai, Y. Kubo, R. O’Connell, B. Weir, K. Yoshino, and P. F. Cannon, “Colletotrichum: species, ecology and interactions,” IMA Fungus, vol. 1, no. 2, pp. 161-165, 2010.

[6] R. Huang, W. Sun, L. Wang, Q. Li, S. Huang, L. Tang, T. Guo, J. Mo, and T. Hsiang, “Identification and characterization of Colletotrichum species associated with anthracnose disease of banana,” Plant Pathology, vol. 70, no. 8, pp. 1-11, 2021.

[7] U. Krauss, R. Bidwell, and J. Ince, “Isolation and preliminary evaluation of mycoparasites as biocontrol agents of crown rot of banana,” Biological Control, vol. 13, no. 2, pp. 111-119, 1998.

[8] R. H. Stover and N. W. Simmonds, “Disease and disorders,” in Bananas, R. H. Stover and N. W. Simmonds, Eds. New York: Wiley, 1987, pp. 281-323.

[9] D. S. Meredith, “Studies on Gloeosporium musarum Cke. & Mass. causing storage rots of Jamaican Banana,” Anthracnose and its chemical control, vol. 48, no. 2, pp. 279-290, 1960.

[10] J. Cano, J. Guarro, and J. Gené, “Molecular and morphological identification of Colletotrichum species of clinical interest,” Journal of Clinical Microbiology, vol. 42, no. 6, pp. 2450-2454, 2004.

[11] P. F. Cannon, P. D. Bridge, and E. Monte, “Linking the past, present and future of Colletotrichum systematics,” In: Colletotrichum: Host specificity, pathology and host-pathogen interaction, D. Prusky, S. Freeman, and M. B. Dickman, Eds. Minnesota: APS PRESS The American Phytopathological Society, 2000, pp. 1-20.

[12] D. S. Hibbett, “Ribosomal RNA and fungal systematics,” Transactions of the Mycological Society of Japan, vol. 33, no. 4, pp. 533-556, 1992.

[13] Y. C. Han, X. G. Zeng, F. Y. Xiang, L. Ren, F. Y. Chen, and Y. C. Gu, “Distribution and characteristics of Colletotrichum spp. associated with anthracnose of strawberry in Hubei, China,” Plant Disease, vol. 100, no. 5, pp. 996–1006, 2015.

[14] B. S. Weir, P. R. Johnston, and U. Damm, “The Colletotrichum gloeosporioides species complex,” Studies in Mycology, vol. 73, no. 1, pp. 115-180, 2012.

[15] W. A. S. Vieira, P. A. Bezerra, A. C. Silva, J. S. Veloso, M. P. S. Câmara, and V. P. Doyle, “Optimal markers for the identification of Colletotrichum species,” Molecular Phylogenetics and Evolution, vol. 143, 2020, Art. no. 106694.

[16] P. R. Johnston and D. Jones, “Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences,” Mycologia, vol. 89, pp. 420-430, 1997.

[17] T. H. Al‐Samarrai and J. Schmid, “A simple method for extraction of fungal genomic DNA,” Letters in Applied Microbiology, vol. 30, no. 1, pp. 53-56, 2000.

[18] B. C. Sutton and J. M. Waterson, “Colletotrichum musae,” in CMI Description of Pathogenic Fungi and Bacteria, no. 222, B. C. Sutton and J. M. Waterson, Eds. London: Eastern Press.

[19] J. Lim, T. H. Lim, and B. Cha, “Isolation and identification of Colletotrichum musae from imported bananas,” The Plan Pathology Journal vol. 18, no. 3, pp. 161-164, 2002.

[20] K. A. Abd-Elsalam, S. Roshdy, O. E. Amin, and M. Rabani, “First morphogenetic identification of the fungal pathogen Colletotrichum musae (Phyllachoraceae) from imported bananas in Saudi Arabia,” Genetics and Molecular Research, vol. 9, no. 4, pp. 2335-2342, 2010.

[21] M. A. I. Sakinah, I. V. Suzianti, and Z. Latiffah, “Phenotypic and molecular characterization of Colletotrichum species associated with anthracnose of banana (Musa spp.) in Malaysia,” Genetics and Molecular Research, vol. 13, no. 2, pp. 3627-3637, 2014.

[22] B. C. Sutton, “The Coelomycetes,” Commonwealth Mycological Institute, Kew, 1980.

[23] S. Freeman, T. Katan, and E. Shabi, “Characterization of Colletotrichum species responsible for anthracnose disease of various fruits,” Plant Disease, vol. 82, pp. 596-605, 1998.

[24] Y. Y. Su, P. Noireung, F. Liu, K. D. Hyde, M. A. Moslem, A. H. Bahkali, K. A. Abd-Elsalam, and L. Cai, “Epitypification of Colletotrichum musae, the causative agent of banana anthracnose,” Mycoscience vol. 52, pp. 376-382, 2011.

[25] K. Tomiyama, M. Takakuwa, N. Takase, and R. Sakai, “Alteration of oxidative metabolism in potato tuber cell invaded by Phytophthora infestans and in the neighbouring tissue,” Phytopathologische Zeitschrift, vol. 37, pp. 113-144, 1959.

[26] D. T. Zhang, Y. L. Gao, Y. H. Huang, M. Yang, and E. X. Zhou, “Identification and biological characteristics of the anthracnose pathogen of postharvest banana fruit,” Journal of Huangzhong Agricultural Univeristy, vol. 30, pp. 438-442, 2011.

[27] A. O. Silva, D. C. Savi, F. B. Gomes, F. M. W. R. Gos, Jr G. J. Silva, and C. Glienke, “Identification of Colletotrichum species associated with postbloom fruit drop in Brazil through GAPDH sequencing analysis and multiplex PCR,” European Journal of Plant Pathology, vol. 147, no. 4, pp. 731-748, 2017.

[28] G. Tao, K. D. Hyde, and L. Cai, “Species-specific real-time PCR detection of Colletotrichum kahawae,” Journal of Applied Microbiology, vol. 114, pp. 828-835, 2012.

[29] M. A. Balendres, J. Mendoza, and F. D. Cueva, “Characteristics of Colletotrichum musae PHBN0002 and the susceptibility of popular banana cultivar to postharvest anthracnose,” Indian Phytopathological, vol. 73, pp. 57-64, 2019.

DOI: https://doi.org/10.34238/tnu-jst.9088

Các bài báo tham chiếu

Hiện tại không có bài báo tham chiếu



Ghi nhớ